ID: 925971674_925971678

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 925971674 925971678
Species Human (GRCh38) Human (GRCh38)
Location 2:9110669-9110691 2:9110693-9110715
Sequence CCTGAGCTGCCGTCCTCAGACCA TCTGCCTCTGAGCGTGCAAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 11, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!