ID: 926101429_926101436

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 926101429 926101436
Species Human (GRCh38) Human (GRCh38)
Location 2:10120698-10120720 2:10120730-10120752
Sequence CCGGACCTGGGGGCAGGAGGGCC TGACTCAGGTTTAGCGCGGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 1, 4: 31}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!