ID: 926101732_926101747

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 926101732 926101747
Species Human (GRCh38) Human (GRCh38)
Location 2:10122474-10122496 2:10122504-10122526
Sequence CCGGGGGGGGAACCGGGAGGTCC CGTCCACGGGGGTGTCCCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 19, 3: 8, 4: 140} {0: 1, 1: 0, 2: 1, 3: 4, 4: 46}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!