ID: 926258905_926258906

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 926258905 926258906
Species Human (GRCh38) Human (GRCh38)
Location 2:11238311-11238333 2:11238330-11238352
Sequence CCTCATGTACACGGATTGGAAGA AAGAATCAATACTATCAAAATGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 18, 3: 67, 4: 226} {0: 1, 1: 15, 2: 500, 3: 8201, 4: 12335}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!