ID: 926706220_926706226

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 926706220 926706226
Species Human (GRCh38) Human (GRCh38)
Location 2:15839619-15839641 2:15839667-15839689
Sequence CCTGATCTCCAAATACTAGATGC CAGGATAAACAAATGGTGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 200} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!