ID: 926706291_926706296

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 926706291 926706296
Species Human (GRCh38) Human (GRCh38)
Location 2:15840111-15840133 2:15840133-15840155
Sequence CCTTCTCAGATCTCTTCCCGGGC CCCAGCACCCTGCAGGCACCTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 6, 3: 86, 4: 579}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!