|
Left Crispr |
Right Crispr |
Crispr ID |
926706291 |
926706296 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
2:15840111-15840133
|
2:15840133-15840155
|
Sequence |
CCTTCTCAGATCTCTTCCCGGGC |
CCCAGCACCCTGCAGGCACCTGG |
Strand |
- |
+ |
Off-target summary |
No data |
{0: 1, 1: 1, 2: 6, 3: 86, 4: 579} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|