ID: 926706294_926706300

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 926706294 926706300
Species Human (GRCh38) Human (GRCh38)
Location 2:15840128-15840150 2:15840141-15840163
Sequence CCGGGCCCAGCACCCTGCAGGCA CCTGCAGGCACCTGGTGCTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 36, 4: 307}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!