ID: 926794590_926794593

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 926794590 926794593
Species Human (GRCh38) Human (GRCh38)
Location 2:16608435-16608457 2:16608462-16608484
Sequence CCCTCATCTATTTTAAGATCGCA TCAGTTTATAGATGGCCAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 111} {0: 1, 1: 0, 2: 0, 3: 14, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!