ID: 926830946_926830949

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 926830946 926830949
Species Human (GRCh38) Human (GRCh38)
Location 2:16961133-16961155 2:16961151-16961173
Sequence CCATTAATTATCTTGTTGTTTAG TTTAGGTGAGTCAAGTGTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 381} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!