ID: 927005653_927005658

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 927005653 927005658
Species Human (GRCh38) Human (GRCh38)
Location 2:18845449-18845471 2:18845495-18845517
Sequence CCCTCCACTTTCTGCCCATATGA GAGCACAGAACCTCAGAGCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 318} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!