ID: 927112989_927112995

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 927112989 927112995
Species Human (GRCh38) Human (GRCh38)
Location 2:19877580-19877602 2:19877606-19877628
Sequence CCCAGCTATTCAGGAGGCTGAGG GAGAGCCTCTTGAACCCTGGAGG
Strand - +
Off-target summary {0: 4324, 1: 106582, 2: 211547, 3: 247830, 4: 263605} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!