ID: 927186278_927186285

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 927186278 927186285
Species Human (GRCh38) Human (GRCh38)
Location 2:20484821-20484843 2:20484835-20484857
Sequence CCCTAACCCAAAATGTGATGGTA GTGATGGTATTAGGAGGTAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 6, 2: 44, 3: 140, 4: 356}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!