ID: 927327345_927327350

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 927327345 927327350
Species Human (GRCh38) Human (GRCh38)
Location 2:21820367-21820389 2:21820413-21820435
Sequence CCTAAACAACAGAAATTTATTTC CTGAAATCAAGGTGCCGGTCTGG
Strand - +
Off-target summary {0: 9, 1: 53, 2: 135, 3: 204, 4: 781} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!