ID: 927333458_927333463

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 927333458 927333463
Species Human (GRCh38) Human (GRCh38)
Location 2:21892844-21892866 2:21892893-21892915
Sequence CCAGCTGCTAAGCCTAGTACTCA TCCTCTCACTTTCTACCCTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 45, 4: 398}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!