ID: 927333458_927333465

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 927333458 927333465
Species Human (GRCh38) Human (GRCh38)
Location 2:21892844-21892866 2:21892897-21892919
Sequence CCAGCTGCTAAGCCTAGTACTCA CTCACTTTCTACCCTGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 80, 3: 552, 4: 1876} {0: 1, 1: 0, 2: 1, 3: 34, 4: 294}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!