ID: 927333459_927333465

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 927333459 927333465
Species Human (GRCh38) Human (GRCh38)
Location 2:21892856-21892878 2:21892897-21892919
Sequence CCTAGTACTCATTAGTTATTTTT CTCACTTTCTACCCTGAGGCAGG
Strand - +
Off-target summary {0: 104, 1: 1031, 2: 1776, 3: 2018, 4: 2500} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!