ID: 927409041_927409051

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 927409041 927409051
Species Human (GRCh38) Human (GRCh38)
Location 2:22804612-22804634 2:22804664-22804686
Sequence CCAGGTCCTTGAGAAAGACATTG AGAAGATTTACATCTCAAAGGGG
Strand - +
Off-target summary No data {0: 18, 1: 36, 2: 85, 3: 92, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!