|
Left Crispr |
Right Crispr |
Crispr ID |
927460916 |
927460921 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
2:23297606-23297628
|
2:23297622-23297644
|
Sequence |
CCTAATCCCCTCTGCTTATAAGG |
TATAAGGACACCAGTCATATTGG |
Strand |
- |
+ |
Off-target summary |
No data |
{0: 199, 1: 801, 2: 1703, 3: 2220, 4: 2101} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|