ID: 927460916_927460921

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 927460916 927460921
Species Human (GRCh38) Human (GRCh38)
Location 2:23297606-23297628 2:23297622-23297644
Sequence CCTAATCCCCTCTGCTTATAAGG TATAAGGACACCAGTCATATTGG
Strand - +
Off-target summary No data {0: 199, 1: 801, 2: 1703, 3: 2220, 4: 2101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!