ID: 927460916_927460924

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 927460916 927460924
Species Human (GRCh38) Human (GRCh38)
Location 2:23297606-23297628 2:23297652-23297674
Sequence CCTAATCCCCTCTGCTTATAAGG TACCTTAATCACCTCTTTAAAGG
Strand - +
Off-target summary No data {0: 10, 1: 103, 2: 342, 3: 630, 4: 1041}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!