ID: 927492691_927492701

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 927492691 927492701
Species Human (GRCh38) Human (GRCh38)
Location 2:23531073-23531095 2:23531115-23531137
Sequence CCTGGATGCACAGTGAGGTAGAG TCTGGGACTCGGCAGAAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 199} {0: 1, 1: 0, 2: 0, 3: 14, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!