ID: 927519437_927519444

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 927519437 927519444
Species Human (GRCh38) Human (GRCh38)
Location 2:23690112-23690134 2:23690127-23690149
Sequence CCCCTCTCCTCCTGGCCATGCCT CCATGCCTGTGCTGAGGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 83, 4: 813} {0: 1, 1: 0, 2: 3, 3: 31, 4: 386}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!