ID: 927519438_927519446

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 927519438 927519446
Species Human (GRCh38) Human (GRCh38)
Location 2:23690113-23690135 2:23690131-23690153
Sequence CCCTCTCCTCCTGGCCATGCCTG GCCTGTGCTGAGGCCCTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 71, 4: 642} {0: 1, 1: 0, 2: 10, 3: 67, 4: 535}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!