ID: 927558729_927558734

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 927558729 927558734
Species Human (GRCh38) Human (GRCh38)
Location 2:24053912-24053934 2:24053928-24053950
Sequence CCCCAAGAAGGGCCAAACGTGTG ACGTGTGTGGTGCACTACACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 77} {0: 1, 1: 0, 2: 2, 3: 2, 4: 46}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!