|
Left Crispr |
Right Crispr |
| Crispr ID |
927610243 |
927610250 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:24531680-24531702
|
2:24531725-24531747
|
| Sequence |
CCCACCTGTGAATGAGAACATAC |
TGATAGTTTGCTGAGAATGATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 35, 2: 1035, 3: 10674, 4: 20583} |
{0: 3456, 1: 11192, 2: 10129, 3: 4750, 4: 3607} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|