ID: 927751427_927751442

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 927751427 927751442
Species Human (GRCh38) Human (GRCh38)
Location 2:25673632-25673654 2:25673664-25673686
Sequence CCCAGCGCGAGCGCGCGGCCGGG TCCGCGCGCGGGGAGGGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 135} {0: 1, 1: 1, 2: 14, 3: 71, 4: 489}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!