ID: 927783914_927783922

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 927783914 927783922
Species Human (GRCh38) Human (GRCh38)
Location 2:25959313-25959335 2:25959349-25959371
Sequence CCCCCTGTGAGCTCCCTCATGGC TACTCATATCTCTGGGTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 251} {0: 1, 1: 0, 2: 1, 3: 16, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!