ID: 927783915_927783922

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 927783915 927783922
Species Human (GRCh38) Human (GRCh38)
Location 2:25959314-25959336 2:25959349-25959371
Sequence CCCCTGTGAGCTCCCTCATGGCA TACTCATATCTCTGGGTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 280} {0: 1, 1: 0, 2: 1, 3: 16, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!