ID: 927891533_927891548

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 927891533 927891548
Species Human (GRCh38) Human (GRCh38)
Location 2:26753378-26753400 2:26753431-26753453
Sequence CCCAAAGTGCTGGGATTTCAGGT GTTTTTAAGGGTTTTGGAGAGGG
Strand - +
Off-target summary {0: 385, 1: 75426, 2: 306750, 3: 245351, 4: 150298} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!