ID: 927891534_927891548

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 927891534 927891548
Species Human (GRCh38) Human (GRCh38)
Location 2:26753379-26753401 2:26753431-26753453
Sequence CCAAAGTGCTGGGATTTCAGGTG GTTTTTAAGGGTTTTGGAGAGGG
Strand - +
Off-target summary {0: 368, 1: 71808, 2: 207412, 3: 251313, 4: 204268} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!