ID: 927891539_927891550

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 927891539 927891550
Species Human (GRCh38) Human (GRCh38)
Location 2:26753406-26753428 2:26753441-26753463
Sequence CCACTTCGCCTGGCCTGGGGCTA GTTTTGGAGAGGGCTGAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 94, 4: 794} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!