ID: 927973664_927973668

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 927973664 927973668
Species Human (GRCh38) Human (GRCh38)
Location 2:27322091-27322113 2:27322119-27322141
Sequence CCTTTGTGGGGGCCCTATGCCAT ATATGAAAGTGCTTTGCATACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 73} {0: 1, 1: 0, 2: 3, 3: 36, 4: 296}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!