ID: 927973664_927973669

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 927973664 927973669
Species Human (GRCh38) Human (GRCh38)
Location 2:27322091-27322113 2:27322141-27322163
Sequence CCTTTGTGGGGGCCCTATGCCAT GTAAAATGTTTTCCAAGTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 73} {0: 1, 1: 0, 2: 1, 3: 28, 4: 282}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!