ID: 928175805_928175810

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 928175805 928175810
Species Human (GRCh38) Human (GRCh38)
Location 2:29033634-29033656 2:29033668-29033690
Sequence CCAGGGGTGGCTCTGGGGTGGAC GGGTATCGCTGAGACCTAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 284} {0: 1, 1: 0, 2: 0, 3: 4, 4: 55}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!