ID: 928176334_928176339

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 928176334 928176339
Species Human (GRCh38) Human (GRCh38)
Location 2:29036753-29036775 2:29036768-29036790
Sequence CCTGGGTGAGTGTCCCACGTGGG CACGTGGGCCTGTGTGGCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 109} {0: 1, 1: 1, 2: 2, 3: 19, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!