ID: 928186655_928186661

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 928186655 928186661
Species Human (GRCh38) Human (GRCh38)
Location 2:29115989-29116011 2:29116009-29116031
Sequence CCGCCAGCCGCGGCTGCCCCGAG GAGAGTCCCCGCACGCGCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 576} {0: 1, 1: 0, 2: 0, 3: 3, 4: 42}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!