ID: 928572963_928572973

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 928572963 928572973
Species Human (GRCh38) Human (GRCh38)
Location 2:32627211-32627233 2:32627241-32627263
Sequence CCGCCTCACCGTCCCGAGTAGCT CAGGGGTGCCCCACTACGTCCGG
Strand - +
Off-target summary {0: 1, 1: 107, 2: 7458, 3: 41156, 4: 50413} {0: 1, 1: 0, 2: 13, 3: 601, 4: 8911}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!