ID: 928609868_928609872

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 928609868 928609872
Species Human (GRCh38) Human (GRCh38)
Location 2:32982467-32982489 2:32982506-32982528
Sequence CCCAAGACAGTGGGCTTAATCAC CAAGTTAATCACCAAGACAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 141} {0: 1, 1: 0, 2: 53, 3: 840, 4: 1510}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!