ID: 928609870_928609872

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 928609870 928609872
Species Human (GRCh38) Human (GRCh38)
Location 2:32982489-32982511 2:32982506-32982528
Sequence CCAAGACAGTTAATCACCAAGTT CAAGTTAATCACCAAGACAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 239} {0: 1, 1: 0, 2: 53, 3: 840, 4: 1510}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!