ID: 928897736_928897742

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 928897736 928897742
Species Human (GRCh38) Human (GRCh38)
Location 2:36284176-36284198 2:36284216-36284238
Sequence CCCGCATTAGTTTGTTAAGGATA CCATTTCCCTGCAAAGAACGTGG
Strand - +
Off-target summary {0: 27, 1: 797, 2: 1881, 3: 2913, 4: 3866} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!