ID: 928997353_928997359

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 928997353 928997359
Species Human (GRCh38) Human (GRCh38)
Location 2:37307114-37307136 2:37307148-37307170
Sequence CCCTGCTCCAGTTGTGCATCCAA GACATTGCCAAATGTTCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 113} {0: 1, 1: 48, 2: 284, 3: 780, 4: 1388}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!