ID: 929081498_929081501

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 929081498 929081501
Species Human (GRCh38) Human (GRCh38)
Location 2:38126921-38126943 2:38126948-38126970
Sequence CCTAGAGACTTGTTTAATGGTTT CAAAATGCTCATAGTGATATGGG
Strand - +
Off-target summary {0: 11, 1: 384, 2: 2111, 3: 2125, 4: 1360} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!