ID: 929115368_929115372

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 929115368 929115372
Species Human (GRCh38) Human (GRCh38)
Location 2:38439431-38439453 2:38439448-38439470
Sequence CCCACAACACTCCAACTGGCACT GGCACTTTCAGCTGCTTCATGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 10, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!