ID: 929772342_929772345

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 929772342 929772345
Species Human (GRCh38) Human (GRCh38)
Location 2:44902920-44902942 2:44902946-44902968
Sequence CCAATCAGAGGTACTTTCATTTT ACTACCACACAGAAAAAGGAGGG
Strand - +
Off-target summary {0: 20, 1: 68, 2: 124, 3: 135, 4: 300} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!