ID: 929799084_929799097

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 929799084 929799097
Species Human (GRCh38) Human (GRCh38)
Location 2:45084020-45084042 2:45084065-45084087
Sequence CCACCCTCCTCTCCCTTCTCCCT TCTCAGGAAATACCTGCGTTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!