ID: 929799087_929799094

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 929799087 929799094
Species Human (GRCh38) Human (GRCh38)
Location 2:45084027-45084049 2:45084041-45084063
Sequence CCTCTCCCTTCTCCCTGCAGCAT CTGCAGCATGGACACATAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 97, 4: 798} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!