ID: 929966897_929966920

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 929966897 929966920
Species Human (GRCh38) Human (GRCh38)
Location 2:46542968-46542990 2:46543013-46543035
Sequence CCCAGGCGGGCTGGGGCTGAGCC GGGGGACCATGCCCGGAGGCCGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 2, 3: 36, 4: 337} {0: 4, 1: 0, 2: 1, 3: 11, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!