ID: 929966898_929966912

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 929966898 929966912
Species Human (GRCh38) Human (GRCh38)
Location 2:46542969-46542991 2:46542992-46543014
Sequence CCAGGCGGGCTGGGGCTGAGCCC GGGGCCGGGGCGGGGGCTCCGGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 6, 3: 47, 4: 397} {0: 3, 1: 2, 2: 40, 3: 292, 4: 1914}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!