|
Left Crispr |
Right Crispr |
| Crispr ID |
929974603 |
929974614 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:46620236-46620258
|
2:46620289-46620311
|
| Sequence |
CCCAGGAGTTTGAGAGCAGCCTG |
ACAGAAAAATTAACTGGGTGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 227, 1: 11638, 2: 21598, 3: 30735, 4: 26883} |
{0: 4, 1: 157, 2: 4085, 3: 32909, 4: 77705} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|