ID: 929974604_929974614

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 929974604 929974614
Species Human (GRCh38) Human (GRCh38)
Location 2:46620237-46620259 2:46620289-46620311
Sequence CCAGGAGTTTGAGAGCAGCCTGG ACAGAAAAATTAACTGGGTGTGG
Strand - +
Off-target summary {0: 421, 1: 21888, 2: 42516, 3: 59213, 4: 51295} {0: 4, 1: 157, 2: 4085, 3: 32909, 4: 77705}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!