ID: 930155847_930155849

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 930155847 930155849
Species Human (GRCh38) Human (GRCh38)
Location 2:48106951-48106973 2:48107001-48107023
Sequence CCAAGGATATGAGGCTAGGGCTA GACCTACTTGTTTTTCAGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 73} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!